PDB Entry - 1QWA
(Status - Released)Summary information:
Title: NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.
PDB DOI: https://doi.org/10.2210/pdb1qwa/pdb
Primary publication DOI: https://doi.org/10.1093/nar/gkg866
Entry authors: Finger, L.D., Trantirek, L., Johansson, C., Feigon, J.
Initial deposition on: 1 September 2003
Initial release on: 25 November 2003
Latest revision on: 1 May 2024
Downloads:
Structure coordinates (PDBx/mmCIF)
Structure coordinates (PDBML)
Structure coordinates (PDB)
NMR restraints (TEXT)
NMR restraints V2 (STAR)
Validation report (XML)
Validation report (PDF)
Links to more resources for 1QWA at: