PDB Entry - 1QWA (pdb_00001qwa)

(Status - Released)

Summary information:

Title: NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.

PDB DOI: https://doi.org/10.2210/pdb1qwa/pdb

Primary publication DOI: https://doi.org/10.1093/nar/gkg866

Entry authors: Finger, L.D., Trantirek, L., Johansson, C., Feigon, J.

Initial deposition on: 1 September 2003

Initial release on: 25 November 2003

Latest revision on: 1 May 2024