PDB Entry - 5DTD
(Status - Released)Summary information:
Title: Crystal structure of Fis bound to 27bp DNA F1-8C (AAATTCGTTTGAATTTTGAGCGAATTT)
PDB DOI: https://doi.org/10.2210/pdb5dtd/pdb
Primary publication DOI: https://doi.org/10.1371/journal.pone.0150189
Entry authors: Hancock, S.P., Cascio, D., Johnson, R.C.
Initial deposition on: 17 September 2015
Initial release on: 9 March 2016
Latest revision on: 27 September 2023
Downloads:
Structure coordinates (PDBx/mmCIF)
Structure coordinates (PDBML)
Structure coordinates (PDB)
X-ray diffraction data (PDBx/mmCIF)
Validation report (XML)
Validation report (mmCIF)
Validation report (PDF)
Links to more resources for 5DTD at: