PDB Entry - 5E3L
(Status - Released)Summary information:
Title: Crystal structure of Fis bound to 27bp DNA F1-8G (AAATTGGTTTGAATTTTGAGCCAATTT)
PDB DOI: https://doi.org/10.2210/pdb5e3l/pdb
Primary publication DOI: https://doi.org/10.1371/journal.pone.0150189
Entry authors: Hancock, S.P., Cascio, D., Johnson, R.C.
Initial deposition on: 3 October 2015
Initial release on: 23 March 2016
Latest revision on: 6 March 2024
Downloads:
Structure coordinates (PDBx/mmCIF)
Structure coordinates (PDBML)
Structure coordinates (PDB)
X-ray diffraction data (PDBx/mmCIF)
Validation report (XML)
Validation report (PDF)
Validation report (mmCIF)
Links to more resources for 5E3L at: