PDB Entry - 5E3N (pdb_00005e3n)

(Status - Released)

Summary information:

Title: Crystal structure of Fis bound to 27bp DNA F31 (AAATTTGTAGGAATTTTCTGCAAATTT)

PDB DOI: https://doi.org/10.2210/pdb5e3n/pdb

Primary publication DOI: https://doi.org/10.1371/journal.pone.0150189

Entry authors: Hancock, S.P., Cascio, D., Johnson, R.C.

Initial deposition on: 3 October 2015

Initial release on: 9 March 2016

Latest revision on: 22 May 2024

Downloads:

Structure coordinates (PDBx/mmCIF)

Structure coordinates (PDB)

Structure coordinates (PDBML)

X-ray diffraction data (PDBx/mmCIF)

Validation report (PDF)

Validation report (XML)

Validation report (mmCIF)

Links to more resources for 5E3N (pdb_00005e3n) at: