PDB Entry - 9YZK (pdb_00009yzk)
(Status - Released)Summary information:
Title: Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA
PDB DOI: https://doi.org/10.2210/pdb9yzk/pdb
Entry authors: Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D.
Initial deposition on: 30 October 2025
Initial release on: 18 February 2026
Latest revision on: 18 February 2026
Downloads:
Structure coordinates (PDBx/mmCIF)
Structure coordinates (PDB)
Structure coordinates (PDBML)
X-ray diffraction data (PDBx/mmCIF)
Validation report (XML)
Validation report (mmCIF)
Validation report (PDF)
Links to more resources for 9YZK (pdb_00009yzk) at: