PDB Entry - 9YZK (pdb_00009yzk)

(Status - Released)

Summary information:

Title: Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA

PDB DOI: https://doi.org/10.2210/pdb9yzk/pdb

Entry authors: Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D.

Initial deposition on: 30 October 2025

Initial release on: 18 February 2026

Latest revision on: 18 February 2026

Downloads:

Structure coordinates (PDBx/mmCIF)

Structure coordinates (PDB)

Structure coordinates (PDBML)

X-ray diffraction data (PDBx/mmCIF)

Validation report (XML)

Validation report (mmCIF)

Validation report (PDF)

Links to more resources for 9YZK (pdb_00009yzk) at: